Web Supplement to Dasgupta et al. PNAS 99:2666-2671 (2002).

 

Contents

1. View the paper.

2. View microarray data in text format. (Microarray data are also available from the YFGdb.)

3. View list of Mot1-regulated genes with links to SGD.

4. Complete Materials and Methods.

5. Quantitation of RNA levels in Figure 1.

6. Annotated Venn diagrams from Figure 2 in JPEG format.

Part a: Mot1 repression correlates with diauxic, stress, or alpha-factor induction.

Part b1: Intersect of Mot1 repression, Srb10 repression, and diauxic induction.

Part b2: Intersect of Mot1 repression, NC2 repression, and diauxic induction.

7. Contact information.
Contact David Auble.

Visit the Auble Lab web page or NIEHS Microarray Center.

Materials and Methods

Yeast strains and growth conditions

For microarray analysis and confirmation of microarray hits by Northern blot, wild-type (YPH499; Sikorski and Hieter, 1989)) and congenic mot1-14 and mot1-42 yeast strains were grown in rich medium (YPD) at 30 C to an OD600 ~1.0, then shifted to 35 C for 45 minutes and cells were harvested. To ensure a rapid and reproducible shift to 35 C, 30 C cell cultures were combined with an equal volume of culture pre-warmed to 40 C. Cells were shifted to 35 C because this is the highest temperature that supports growth of our wild-type strain, YPH499. Descriptions of the mot1 strains used in this study will be described in detail elsewhere, but briefly, the mot1-14 allele encodes a premature stop codon in place of the codon for W496; cells with the mot1-14 allele grow poorly at 30 C and virtually undetectably at 35 C. Slow growth at 30 C is attributable to a small degree of translational suppression of the premature stop codon, and cells expressing mot1-14 contain no detectable immunoreactive Mot1 protein. Thus, the mot1-14 strain mimics conditions of nearly complete loss of Mot1 protein. mot1-42 encodes L383P; strains harboring this allele grow at near wild-type rates at 30 C but are growth impaired at 35 C. For comparison, RNA was obtained from the following YPH499-derived strains: WCS132 (tsm1; Lee et al., 2000), JR374 (taf145-869; Walker et al., 1997; Joe Reese unpublished), and SHY258 (toa2-3; Kang et al., 1995). RNA was also prepared from JS306 (BNA1+) and JS663 (bna1-delta; Sandmeier et al., 2001) cells grown in the same way.  The experiment in Figure 3 was performed using haploid yeast cells with a deletion of the chromosomal copy of MOT1, mot1-42 carried on pRS313 (Sikorski and Hieter, 1989) and MOT1+, mot1-K1303A (both pRS315-derived) or pRS315 (Sikorski and Hieter, 1989) plasmid vector alone.  Alternatively, RNA was analyzed from haploid strains containing plasmid-borne mot1-42 and a second plasmid in which expression of mot1-K1303A was under control of the GAL1 promoter.  In this case, mot1-K1303A expression was induced by growth of cells in synthetic media (to select for plasmids) containing 2% galactose and 0.5% sucrose, cells were heat shocked and harvested as above.

RNA isolation and northern blots

Total yeast RNA was isolated using a hot acid phenol extraction protocol (Schmitt et al., 1990). Poly A+ RNA was prepared from total RNA using a Qiagen Oligotex Midi Kit according to the instructions supplied by the manufacturer. For Northern blots, 5-20 micrograms total RNA was separated by electrophoresis in formaldehyde agarose gels, transferred to nitrocellulose and probed with random-primed DNA probes obtained from the cloned genes or by PCR amplification of portions of the open reading frames (ORFs) for the genes of interest. The ACT1 probe was derived from the ~1.1 kb XhoI-HindIII fragment containing the ACT1 gene, the HSP26 probe was derived from the ~3 kb PstI-BamHI fragment containing the HSP26 gene, the MET15 probe was obtained from the 715 bp EcoRI-HindIII fragment containing a portion of the MET15 ORF. Probes for other genes were obtained by PCR of genomic DNA. The THI5 probe probably cross-hybridizes to messages derived from THI11 and THI13 which are nearly identical. Blots were hybridized overnight at 42 C in 50% formamide and washed twice in 0.1X SSC, 0.1% SDS at room temperature for 15 minutes each followed by washing twice in the same buffer at 50 C for 15 minutes each. Bands were detected by autoradiography and band intensities were quantitated using a Phosphorimager.

Microarray hybridization experiments

cDNA microarray chips containing 6024 yeast open reading frames (ORFs) were prepared as previously described (DeRisi et al., 1997; Hauser et al., 1998). Briefly, primers specific for each ORF (Research Genetics, Birmingham AL) were used to amplify yeast ORFs from genomic DNA in a 100 microliter PCR reaction using Amplitaq or Pfu polymerases. The PCR products were run on 2% agarose gels to ensure quality of the reaction products and purified by ethanol precipitation. The purified cDNAs were resuspended in ArrayIt buffer (Telechem, San Jose, CA) and spotted onto poly-L-lysine coated glass slides using a modified, robotic DNA arrayer (Beecher Instruments, Bethesda MD). Poly A+ RNA (2-4ug) was labeled with Cy3 and Cy5-conjugated dUTP (Amersham, Piscataway, NJ) using a reverse transcription reaction and hybridized to the yeast cDNA microarray chip (DeRisi et al., 1997). cDNA chips were scanned using an Axon Scanner (Axon Instruments, Foster City CA), and images were analyzed using the Array Suite Software (Scanalytics, Fairfax, VA). The relative fluorescence intensity was measured for each labeled RNA and a ratio of the values for the intensity of each fluor bound to each probe was calculated. The amount of autofluorescence generated in the Cy3 channel was measured and a minimum intensity cut-off was set just above this value. The distribution of the ratio of all of the genes was calculated and intensity ratio values that differed from the median with a confidence interval of greater than 95.0% (Chen et al., 1997) were scored as significant changes. The same RNA was labeled and hybridized in three independent reactions. The data for each array was normalized using the mean of all of the targets on the array, and the coefficient of variance for each hybridization was less than 0.3. A database tool, MAPS (Bushel et al., 2001) was used to compile the overall list of consistent, significantly changed genes across the multiple hybridizations. Analysis of the data at the 95% confidence level (not shown) indicated that MOT1 controls the expression of 421 genes, 59 of which are activated by MOT1 in wild-type cells. Thus, a less conservative statistical treatment suggests that the number of MOT1-activated genes in the 99% confidence data set may be an underestimate.

Analysis of microarray data

MOT1-controlled genes were functionally grouped manually by annotation of known features for each gene available from SGD, MIPS, and YPD. The alpha-factor time series (Roberts et al., 2000) and diauxic shift expression pattern (DeRisi et al., 1997) were examined for each MOT1-regulated gene. The overlap between MOT1-repressed genes and genes induced during the diauxic shift was initially observed because a number of genes in the MOT1 data set displayed a log2 (ratio) >1 at 18.5 and/or 20.5 hrs in the diauxic shift time course. A number of MOT1-repressed genes were classified as alpha-factor induced because they displayed a log2 (ratio) >1 at some point between 48 and 120 minutes after addition of alpha-factor.

To obtain quantitative estimates of the degree of overlap between the MOT1 microarray data and other data sets, the following analyses were performed. Microarray data for the diauxic shift and TUP1 were taken from http://cmgm.stanford.edu/pbrown/explore/index.html. Ratios of induction or repression were taken directly from the data sets. Alignments of data sets were done in Microsoft Excel 5 and checked using the comparative function [=if(xn=yn,0,100)], where n is the number of a row, and x and y are columns containing the ORF names that correspond to each data point (ORF names and microarray results from each data set are kept in adjoining columns). The function reports a value of zero when the ORF names are identical; when the summation of this function over all 6000+ rows was zero, the alignment was complete. Entries in one data set that were not present in the other data set were deleted. In many cases the same ORF would appear two or three times in one data set; the second and third instances were discarded, except that for some of the diauxic shift data, multiple occurrences of a gene were averaged, using the functions [=exp((ln(a)+ln(b))/2)] or [=exp((ln(a)+ln(b)+ln(c))/3)] where a, b, and c are cells containing replicate results. For the purpose of counting genes significantly affected in a given microarray, another Microsoft Excel function was used: [=if(x>2,1,0)] or [=if(x<0.5,1,0)], where x is a cell containing an induction/repression ratio. Genes affected significantly in two microarrays could be counted using functions such as [=if(if(xn>2,1,0)+if(yn>2,1,0)>1,1,0)] where x and y are columns containing induction or repression ratios, and n is a row. Summation of these functions over all rows gives the total number of genes in the intersection.

Microarray data for TAF145, TSM1, GCN5, and SPT3 was taken from the site http://web.wi.mit.edu/young/pub/expressionanalysis.html. This data was not reported in the form of ratios, but as intensities. To adjust for fluctuations in the readings, the operation [=if(x<10,10,0)] (where x is a cell) was used to set the baseline to 10, as recommended at the same web site. Repression ratios were then computed, and data sets were aligned as above. For many genes, the computed ratio is exactly equal to one; this was taken as an indicator that neither in the normal nor in the mutant strain did the intensity of the hybridization rise above the baseline, and these genes were removed from the alignment. The data for NC2 (BUR6) is available at the same web site; it had, however, already been edited so that the baseline was at 20. Genes for which neither reading was above baseline were again discarded.

Correlation coefficients were calculated using the Excel "CORREL" function. Venn diagrams were constructed in Deneba Canvas 5 (Miami, Florida) as follows: first a circle was drawn for one of the data sets; succeeding figures were made by scaling the first circle appropriately, then reshaped by eye to make the intersects the correct sizes. Areas of all shapes and intersections were checked in the "Object Info" window; errors were mostly in the range of 10%, but rising above 20% for some of the smaller objects and overlaps. The pie chart was made in Kaleidagraph (Synergy Software, Reading, Pennsylvania).

Yeast stress response data used in making the expression tree were taken from http://genome-www.stanford.edu/yeast_stress/ (Gasch et al. 2000). Cluster and Treeview programs are available at Michael Eisen's web site.

The promoter sequences of the MOT1-activated genes were analyzed using the Wconsensus algorithm with default parameters; no shared DNA sequence elements were identified with statistically-significant expected frequencies (not shown).

Chromatin immunoprecipitation

Chromatin immunoprecipitation was performed as described with minor modifications using strains containing TAP-tagged (Rigaut et al., 1999) or untagged MOT1. Chromatin was prepared as described (Kuo and Allis, 1999) with the following modifications. Cells were grown in 100 ml YPD to an OD600 of ~1.0 and were treated with 1% formaldehyde for 15 min at room temperature with occasional swirling. Cells were immediately harvested and washed twice with cold TBS (20 mM Tris-HCl, pH 7.5, 150 mM NaCl) and once with FA-lysis buffer (50 mM Hepes-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 0.1% Sodium deoxycholate, 1% triton X-100, 1 mM PMSF, 1 ?g/ml leupeptin, 1 ?g/ml pepstatin A. Cells were then resuspended in 800 ?l of FA lysis buffer and transferred to 2 ml screw-capped tubes. An equal volume of acid-washed glass beads (425-600 microns) was added and the cells were disrupted in FastPrepTM FP120 (Savant) at 4oC. The cell lysate was subsequently sonicated to yield an average DNA fragment size of 500 base pairs (bp) (range 100-700 bp). The cell debris was removed by centrifugation at 14000 X g for 5 minutes. The lysate was transferred to another tube and further centrifuged at 14000 X g for another 15 minutes to yield the chromatin solution ready for immunoprecipitation. Formaldehyde-crosslinked chromatin solution from the untagged and epitope-tagged MOT1 strain was incubated with 20 ?l of IgG sepharose beads (1:1 slurry equilibrated with FA-lysis buffer) for 2 hrs at 4oC on a rotator. The beads were then recovered by centrifugation at 14000 X g for 15 seconds. The beads were washed twice for 5 minutes in 1.4 ml FA lysis buffer, twice in 1.4 ml FA-lysis buffer with 500 mM NaCl and once in 10mM Tris-HCl, pH 8.0, 250 mM LiCl, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA. The immunoprecipitated material was eluted with 190 ?l of 2% SDS, 0.1 M NaHCO3 at room temperature. This elution step was repeated once more and the eluates are combined.

To reverse crosslinks NaCl was added to 250 mM and the samples are incubated at 65oC for 5 hrs. About 10% of chromatin solutions with reversed crosslinks were reserved for later analysis as 'input' controls. The protein and DNA was ethanol precipitated overnight at -20oC. After centrifugation at 14000 X g at 4oC for 15 min, the pellet was washed with 70% ethanol and air dried and resuspended in 180 ?l of TE (10mM Tris-HCl, pH 8.0, 1 mM EDTA). RNase was added to 20 ?g/ml and the samples were incubated at 37oC for 30 min. Following RNase digestion, 20 ?l of 10X proteinase K digestion buffer (0.1 M Tris, pH 8.0, 50 mM EDTA, 5% SDS) and 1 ?l of 20 ?g/?l of proteinase K was added and the samples were incubated at 42 C for 2 hrs. After extraction with phenol-chloroform-isoamyl alcohol and chloroform, DNA was ethanol-precipitated overnight at -20 C in the presence of 20?g glycogen and resuspended in TE buffer. Quantitative PCR was performed using approximately 1/100 of the material recovered after the IP and 1/10000 of the input DNA. Typically the PCR reactions were carried out in 50 ?l reaction mixture (20 mM Tris-HCl, pH 8.4, 1.5 mM MgCl2, 0.2 mM each dNTP, 1 ?M each primer and 2.5 U Taq polymerase (GIBCO BRL). The PCR was performed as follows: 2 min at 94 C, then 26 cycles of 30 seconds at 94 C, 1 minute at 52 C and 1 minute at 72 C; followed by a final extension of 7 minutes at 72 C. All PCR products were separated on 15% polyacrylamide gels which were stained with ethidium bromide and visualilized by the AlphaImager digital camera (Alpha Innotech Corp.). AlphaEase program, version 4.0 was used to quantify the captured ethidium bromide-stained image. Quantification was performed by calculating the difference in band intensities between the tagged and untagged samples, normalized to the band intensities obtained using the input samples. The normalized PCR signal obtained using primers for MOT1-controlled promoters was roughly three-fold greater than the signal obtained using primers for other promoters or ORFs (except the ACT1 ORF), and the analysis was performed at least 3 times using two independently prepared batches of chromatin.

PCR was performed with the following pairs of primers (PCR product sizes in parentheses):

Northern probes:

5'-ACTACACCAATTAATATCGACAAATG-3' and 5'-ATTAGATTGAGGGCGTGCGTA-3' (BNA1, 522 bp); 5'-GACAGCCAGTTTAACTACCAAGTTCT-3' and 5'-TTCAACTTCCCACGGAACTGAT-3' (URA1, 933 bp); 5'-ATCAAAGCTACGGCGGTGTATT-3'and 5'-CCCTGTGTATTTGTTAAATTGTTCAC-3' (SGA1, 1439 bp); 5'-TCTTTCGCTCATTTTACCTACCTG-3' and 5'-ACATTGCAAGCAACTGCCAT-3' (AGA1, 2156 bp); 5'-CTCATCGTGGCATCTTTGTT-3' and 5'-TCAGGGGCAGTAGTTAGATCAT-3' (TSL1, 887 bp); 5'-GTCAAAGGCAGTAGGTGATTTAGG-3' and 5'-TAAGCTTGGTAGGTTGAGGAAGA-3' (GND2, 1476 bp); 5'-CCGCTCGAGAAATGTTAGTTTTATCCTTGA-3'and 5'-CGGGATCCTTACAACAATCTCTCTTCGAAT-3' (INO1, ~1.67 kb); 5'-CCCAAAAAAAGTTTTACTCGCTC-3'and 5'-TAAAGCGTCGATGGATCTTACG-3' (YDR533C, 700 bp); 5'-GAGGAAGCTAAATCCAGCTTTAGA-3'and 5'-CCGTACCTTTTCCAATTTTCA-3' (YDR539W, 1500 bp); 5'-TGTCAGAACCTTCAGAGAAAAAACA-3'and 5'-TCTTCAACCAGTTTGTACAGTGC-3' (YGR043C, 991 bp); 5'-TGTAACCAAATACTTTTACAAGGGTG-3' and 5'-AATTGTAGGCTTTGGTTCCG-3' (YHR087W, 326 bp); 5'-ACAAGATCACATTTTTGTTGAACTG-3'and 5'-CTGGAAGAGCCAATCTCTTGAA-3' (THI5, 1008 bp)

Chromatin immunoprecipitation:

5' - TATTCTTTGATTGCGCTGCC-3' and 5' - CGATTTTTTTGGTAAATGTATGC-3' (BNA1 promoter, 336 bp); 5' - GAAATGAAGATTCTTGTTCATGTG A-3' and 5'- TGTTGCTGAGATTTGTGACGGT-3' (RPL5 promoter, 344 bp); 5' - CCTTTTGTT CTTCACGTCCTTTT-3' and 5'- CGACAACAGAACAAGCCAAA-3' (INO1 promoter, 292bp); 5'- GGGAAAAAAGGAAAAGGAGCA-3' and 5'- GTTTGGTACGGAAGT TCAATTTT-3' (URA1 promoter, 490 bp); 5'- AACTCCGTGTGTACCCCTAACT-3' and 5' - GTTTGTTTGTTTGCTTTTTTGG-3' (HSP26 promoter, 479 bp); 5' - AAC GTAAAATAAATAATACTGTTC-3' and 5' - AAGCTGAGGTTACAAGACTATGAG-3' (SAN1 promoter, 326 bp); 5' -TCCTTATCGGATCCTCAAAACC-3' and 5'- CAGTAAATTTTCGATCTTGGGAAG (ACT1 promoter, 479 bp); 5' - TGTTCGTGCATTTTACACTCG-3' and 5'- AACTTCCCACGGAACTGATCTA-3' (URA1 orf, 231 bp); 5'- ACATTCATTGCGGGAGACGA-3' and 5'- CCGACGGGCTTCATATATATTTGA-3' (INO1 orf, 287 bp); 5'- CTGTGGGTATTGTTGTGGAACA-3' and 5'- ATTAGATTGAGGGCGTGCGTA-3' (BNA1 orf, 218 bp); 5'- CTCACTGAACAACAACGCACTCTC-3' and 5' - CTCACTGAACAACAACGCACTCTC-3' and 5' - ATCTGTTCGCCAGAACTTGCATTT-3' (SAN1 orf, 358 bp); 5'- TTAATAACATTCAGACATTATTGAAA-3' and 5'- CCTTCATATTAAGGAAACAACTCCTC-3' (RAD16 orf, 187 bp); 5' -CTACCTCACGCCATTTTGAGAA-3' and 5'-AGTGATGACTTGACCATATGGAA-3' (ACT1 orf, 237 bp)

References

Bushel, P., Hamadeh, H., Bennett, L., Sieber, S., Martin, K., Nuwaysir, E. F., Johnson, K., Reynolds, K., Paules, R., and Afshari, C. A. (2001). MAPS: A Microarray Project System for gene expression experiment information and data validation. Bioinformatics 17, 564-565.

Chen, Y., Dougherty, E. R., and Bittner, M. L. (1997). Ratio-based decisions and the quantitative analysis of cDNA microarray images. J Biomed Optics 2, 364-374.

DeRisi, J. L., Iyer, V. R., and Brown, P. O. (1997). Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278, 680-686.

Gasch, A. P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., Storz, G., Botstein, D., and Brown, P. O. (2000). Genomic Expression Programs in the Response of Yeast Cells to Environmental Changes. Mol Biol Cell 11, 4241-4257.

Hauser, N. C., Vingron, M., Scheideler, M., Krems, B., Hellmuth, K., Entian, K.-D., and Hoheisel, J. D. (1998). Transcriptional profiling on all open reading frames of Saccharomyces cerevisiae. Yeast 14, 1209-1221.

Kang, J. J., Auble, D. T., Ranish, J. A., and Hahn, S. (1995). Analysis of the Yeast Transcription Factor TFIIA: Distinct Functional Regions and a Polymerase II-Specific Role in Basal and Activated Transcription. Mol Cell Biol 15, 1234-1243.

Kuo, M. H., and Allis, C. D. (1999). In Vivo Cross-Linking and Immunoprecipitation for Studying Dynamic Protein:DNA Associations in a Chromatin Environment. Methods 19, 425-433.

Lee, T. I., Causton, H. C., Holstege, F. C. P., Shen, W.-C., Hannett, N., Jennings, E. G., Winston, F., Green, M. R., and Young, R. A. (2000). Redundant Roles for the TFIID and SAGA Complexes in Global Transcription. Nature 405, 701-704.

Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999). A Generic Protein Purification Method for Protein Complex Characterization and Proteome Exploration. Nature Biotech 17, 1030-1032.

Roberts, C. J., Nelson, B., Marton, M. J., Stoughton, R., Meyer, M. R., Bennett, H. A., He, Y., Dai, H., Walker, W. L., Hughes, T. R., et al. (2000). Signaling and Circuitry of Multiple MAPK Pathways Revealed by a Matrix of Global Gene Expression Profiles. Science 287, 873-880.

Sandmeier, J. J., Celic, I., Boeke, J. D., and Smith, J. S. (2001). Telomeric and rDNA Silencing in Saccharomyces cerevisiae is Dependent on a Nuclear NAD+ Salvage Pathway. submitted.

Schmitt, M. E., Brown, T. A., and Trumpower, B. L. (1990). A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res 18, 3091-3092.

Sikorski, R. S., and Hieter, P. (1989). A System of Shuttle Vectors and Yeast Host Strains Designed for Efficient Manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.

Walker, S. S., Shen, W. C., Reese, J. C., Apone, L. M., and Green, M. R. (1997). Yeast TAFII145 Required for Transcription of G1/S Cyclin Genes and Regulated by the Cellular Growth State. Cell 90, 607-614.
 
 

Quantitation of Northerns (Figure 1)

Part A: MOT1-regulated genes.

gene name  Ratio mot1-14 to MOT1+ Ratio mot1-42 to MOT1+ Ratio taf145-869 to TAF145+ Ratio tsm1 ts to TSM1+ Ratio toa2-3 to TOA2+
INO1 5.9  4.9  0.75  1.2  0.97 
THI5 4.6  4.5  0.78  1.2  0.38 
YDR533C 4.5  4.2  1.6  2.5  0.70 
YGR043C 5.2  5.3  3.2  1.9  1.1 
AGA1 4.5  3.0  0.35  1.1  0.36 
HSP26 3.8  4.5  4.2  1.7  2.3 
TSL1 3.2  1.8  2.1  1.4  1.4 
BNA1 0.26  0.49  0.15  0.46  0.19 
URA1 0.28  0.50  0.45  1.2  0.54 
YDR539W 0.26  0.38  0.32  0.51  0.20

Part B: Genes not affected by MOT1 mutation.

gene name  Ratio mot1-14 to MOT1+ Ratio mot1-42 to MOT1+ Ratio taf145-869 to TAF145+ Ratio tsm1 ts to TSM1+ Ratio toa2-3 to TOA2+
RPL5 1.0  1.2  0.44  1.6  0.80 
RPS5 1.1  1.2  0.38  1.5  0.76 
ACT1 1.3  1.6  0.78  2.0  1.1 
SAN1 0.7  0.9  0.6  0.9  1.0 
RAD16 0.8  1.2  0.9  0.7 

Part C: BNA1 does not regulate MOT1-controlled genes.

gene name  Ratio mot1-14 to MOT1+ Ratio bna1 delta to BNA1+
GND2 3.6  0.84 
HSP26 7.6  0.60 
YHR087W 1.9  0.92 
SGA1 3.0  0.90 
BNA1 0.76  0.25